Alianza y Nueva Mayoría se unen contra el Paro Docente adelantando vacaciones y reteniendo sueldos

4

ALIANZA NUEVA MAYORIA LA MISMA MIERDA 1

 

 

 

Por más que Alianza y Nueva Mayoría nos vendan una diferencia sustancial entre ellas, la realidad es que, con pequeños matices, ambas coaliciones defienden los mismos intereses neoliberales; en el caso de la carrera docente, una reforma que ha creada entre cuatro paredes sin consultar ni a profesores ni a estudiantes. Un artículo de Radio Villa Francia explica las presiones que en han realizado en conjunto para parar el Paro Docente.

 

Una ofensiva de parte del gobierno, que comenzó ayer jueves con las declaraciones del Ministro Eyzaguirre quien dijo que “el proyecto de carrera docente no se retirará del Congreso” y a las que se sumaron las hecha por la actual ministra de Justicia, Javiera Blanco, quien se refirió al Paro de los profesores como “una paralización ilegal“, han marcado las gestiones del ejecutivo para poder dar termino al Paro Docente que ya cumple 25 días. Esto luego de que el día miércoles, en una tensa asamblea en el Colegio de Profesores, se decidiera continuar el Paro por 131 votos a favor y 41 en contra -en donde se registraron 6 abstenciones- y de paso, rechazar el trabajo de la mesa tripartita que se abría a hacer modificaciones. Los profesores argumentan que su rechazo es estructural al proyecto,pues este se plantea desde una lógica de mercado y competencia.

 

En este contexto este jueves 25 de junio se sumaron las declaraciones de los 5 miembros de la comisión de educación del Senado (que tiene representantes de partidos de la Alianza y la Nueva Mayoría), quienes hicieron una declaración conjunta para llamar a los docentes a deponer el Paro Indefinido, con el argumento de “que este paro perjudica a los alumnos más vulnerables y debilita la educación pública y que el espacio de debate es el parlamento“. Los Senadores/as Fulvio Rossi (PS), Ena Von Baer (UDI), Ignacio Walker (DC), Andrés Allamand (RN) y el presidente de la comisión, Jaime Quintana (PPD) hicieron también un llamado al MINEDUC a ingresar el proyecto de carrera docente y discutirlo en los espacio que corresponde, según ellos, el Congreso.

 

El Senador del Partido Socialista, Fulvio Rossi dijo que la prolongación del paro “es absolutamente inentendible. Se han generado todas las instancias de diálogo y participación“; mientras Von Baer enfatizó que “el primer responsable de destrabar este conflicto es el ministro de Educación, porque es el responsable político de sacar adelante la Carrera Docente“. Por su parte el senador de Renovación Nacional, Andrés Allamand indicó que “El Colegio de Profesores, en su intransigencia ha demostrado que no le tiene ningún respeto al funcionamiento de las instituciones democráticas. Pretende reemplazar al Gobierno y al Congreso que son, por definición, los llamados a desarrollar y aprobar la legislación“.

 

Medidas que se suman a las hechas ya por el Mineduc quien esta semana hizo un requerimiento a los encargados de establecimientos educacionales con el fin de adelantar las vacaciones y de paso no se afecte el calendario escolar debido al Paro de Profesores. Medida que fue leída por el profesorado como un forma de romper el Paro que llevan adelante.

 

 

 

 

 

1) LO DE «EL PARO PERJUDICA A LOS ESTUDIANTES» ES EL MISMO CHANTAJE DE «LAS REFORMAS PERJUDICAN EL CRECIMIENTO». LOS PROFES ESTÁN EN PARO PRECISAMENTE POR LOS ESTUDIANTES, ESTA REFORMA CREADA ENTRE 4 PAREDES ES HORRIBLE

 

 

2) LOS UDI PENTA Y EL GOBIERNO DE LA MANITO PARA SACAR ADELANTE EL MISMO PROYECTO… ¿QUIÉN LE HACE EL JUEGO A LA DERECHA?

 

 

 

 

 

 

Compartir.

4 comentarios

  1. Politicos, CORRUPTOS…Mejor cierren el parlamento… Estamos en el paro para no terminar pateando piedras…EYZAGUIRRE, economista que no tiene idea de EDUCACION…Que nos llevamos pega para la casa y una evaluacion de carton…

  2. ah .pero son igualmente corruptos y coimeros.asi que la educacion,las reformas pueden esperar hasta el 2048 con estos malos representantes del people…………………..menos mal que a eizaguirre no lo mandaron a obras publicas……sino tendriamos otro puente cacacacacacucaucccacaccucauaucacu…..jejejej

  3. EL MAS ZURDO DE TODOS RECUERDEN on

    MALDITOS SOCIALISTAS…QUE DEMOCRACIA…MARIONETAS DEL PODER. ESTE PAIS HACE RATO QUE DEBIERA ESTAR ARDIENDO! VIVA EL PUEBLO,VIVAN LOS TRABAJADORES! PUEBLO CONCIENCIA FUSIL…MIR, MIR!

Dejan tu comentario